Skip to main content

Table 2 Primers used virulence factor detection

From: Zinc phosphate-based nanoparticles as alternatives to zinc oxide in diet of weaned piglets

Virulence factor Primer sequence (5′→3′) PCR product size, bp Reference
F18 TGGTAACGTATCAGCAACTA 313 [20]
ACTTACAGTGCTATTCGACG   
F4 GCCTGGATGACTGGTGATTT 709 [21]
TCTGACCGTTTGCAATACCC   
STa CAACTGAATCACTTGACTCTT 158 [20]
TTAATAACATCCAGCACAGG   
STb TGCCTATGCATCTACACAAT 113 [20]
CTCCAGCAGTACCATCTCTA   
Stx2 (VT2) GTTTTTCTTCGGTATCCTATTCC 484 [22]
GATGCATCTCTGGTCATTGTATTAC   
uidA TGTTACGTCCTGTAGAAAGCCC 153 [23]
AAAACTGCCTGGCACAGCAATT