Skip to main content

Table 1 Primer sequences used for real-time quantitative PCR

From: Impact of post-ruminally infused macronutrients on bovine mammary gland expression of genes involved in fatty acid synthesis, energy metabolism, and protein synthesis measured in RNA isolated from milk fat

Gene1 Forward primer (5′→3′) Reverse primer (5′→3′) Accession No. reference
ACC1 GTGAAGTTCCCTCAGGCTCTTAATC TGTCTGAGCAGATATCCACTTCC NM_174224.2
CASP3 CAGCGTCGTAGCTGAACGTA GTTTGCTGCATCCACGTCTG NM_001077840
CCND1 GCTCCTGTGCTGCGAGATG GCTCTTTTTCACGGGCTCCA NM_001046273
CDC42BPA ATGAAAAGGATGCACGAGGGT GGCATATCTGTTGCTCGGGT NM_001192937.2
CSN2 CAGGCCTTTCTGCTGTACCA CAAAAGTGAGGAGGGGGCAT KC993858
DDIT3 CAAAGCCGGAACCTGAGGAG TCCTGCAGGTCCTCATACCA NM_001078163
DDIT4 AGCCTTTGGGATCGCTTCTC GCTGATTTGGGGTGGGAGTT NM_001075922
EIF2A TACAGAAACCATGCCCATCA TGCAAGTTCGGTCTCATCTG NM_175813
EIF2AK3 GGCTGAAAGATGACAGCACA AGAACTGGCTCTCGGATGAA NM_001098086
EIF2B5 ACTGACAAAGGCCAGCAGTT GACGGTGGTCACTCATCCTT XM_002684878
EIF4E CAGTGCTGTGCCTTATTGGA TGCATGGGACTGATAACCAA NM_174310
FASN CCAAGTCGAACATGGGACAT GATCTTGGGGTTTGGGTTGT NM_001012669.1
GAPDH GGGTCATCATCTCTGCACCT GGTCATAAGTCCCTCCACGA NM_001034034
HSPA5 TGAACGACCCCTGACGAAAG TGCGCTCCTTGAGCTTTTTG NM_001075148
IDH1 ACACTGAGTGACTGTGTGCTC CTTGGTGACCTGGTCGTTGG NM_181012.3
LALBA AGTCCTTTCGTCCCAGCACTA AACCGGAGTCTGCTTGATGA JN258330
ME2 GTTCTCCCCGGTCAGTCTCCT TTTTCTCACCCCGCTTCTTGC NM_001076814.1
MYC GTAGTAATTCCAGCGAGAGGCA TAGGCTAGCTCGGCTCTTCC NM_001046074
PCK2 GCATCCCAACTCTCGCTTTTG GGGGGACTCCTTTGGGTCT NM_001205594.1
PPP1R15A CAACCAGGAGACACAGAGGA ACTCTGGGTTGAAGGGAGG NM_001046178
PRKAA1 AGCCCTTCCTTCTCTTGCTC AGGATGCCTGAAAAGCTTGA NM_001109802
RPL15 ACACTATTGGTGGCTCTCGC ACAAACATCACGTGTTAGCGG XM_005226176
RPS6 TGTGCGAAAGCCCCTAAACA GGAGTCACGAGACGCTGAAT NM_001015548
RPS6KB1 TGACAGCCCAGATGACTCAG TGGGCTGCCAATAATCTTC NM_205816
RPS9 CTGAAGCTGATCGGCGAGTA GGGTCTTTCTCATCCAGCGT NM_001101152.2
UXT CGCTACGAGGCTTTCATCTC CCGAGTGGTTAGCTTCCTGG NM_001037471.2
XBP1s TGCTGAGTCCGCAGCAGGTG AGAATGCCCAACAGGATGTC BC102639
XBP1u AGACTACGTGCACCTCTGCAG AGAATGCCCAACAGGATGTC BC102639
  1. 1ACC1 = acetyl-CoA carboxylase 1; CASP3 = caspase 3; CCND1 = cyclin D1; CDC42BPA = CDC42 binding protein kinase alpha; CSN2 = β-casein; DDIT3 = DNA damage-inducible transcript 3; DDIT4 = DNA damage inducible transcript 4; EIF2A = eukaryotic initiation factor 2, α subunit; EIF2AK3 = eukaryotic translation initiation factor 2, alpha kinase 3; EIF2B5 = eukaryotic translation initiation factor 2B, ε subunit; EIF4E = eukaryotic translation initiation factor 4E; FASN = fatty acid synthase; GAPDH = glyceraldehyde 3-phosphate dehydrogenase; HSPA5 = H3 histone, family 3A; IDH1 = isocitrate dehydrogenase 1, cytosolic; LALBA = α-lactalbumin; ME2 = malic enzyme 2, mitochondrial; MYC = MYC proto-oncogene; PCK2 = phosphoenolpyruvate carboxykinase 2, mitochondrial; PPP1R15A = protein kinase AMP-activated catalytic, α1 subunit; PRKAA1 = protein kinase AMP-activated catalytic, α1 subunit; RPL15 = ribosomal protein L15; RPS6 = ribosomal protein S6; RPS6KB1 = ribosomal protein S6 kinase B1; RPS9 = ribosomal protein S9; UXT = ubiquitously expressed prefoldin like chaperone; XBP1s = X-box binding protein 1, spliced; XBP1u = X-box binding protein 1, unspliced