Skip to main content

Table 1 Primer sequences for the RT-PCR and q-PCR analyses

From: Establishment of cell lines with porcine spermatogonial stem cell properties

GeneForward primer (5'→3')Reverse primer (5'→3')Product size, bp
UCHL1CAGTAGCCAATAATCAGGACAAGGCATCCGACCATCAAG249
PLZFGCGGAAGACCTGGATGACCTGTCGTCTGAGGCTTGGATGGT105
THY1TACCACCAACCTGCCCATTCAGAAGTTGGTTCGAGAGCGG116
VASATATGATGCGGGATGGAATAACTGACAGCTCTTACACAAGTCCCAA144
DAZLCCTTTGCTGACCCACAGTCTGTGAGGGACTGGCCAATGAA220
CXCR4TCTACGCTTTCCTTGGAGCCGAAGAATGTCCACCCCGCTT115
SV40AGAACAGCCCAGCCACTATAACCAAGCAACTCCAGCCAT256
PCNAGAACAGGAGTACAGCTGTGTACAGGCTCATTCATCTCTATGG220
GAPDHTCGGAGTGAACGGATTTGGCTGACAAGCTTCCCGTTCTCC189
HPRT1TTATGCCGAGGATTTGGAAAAGGTTATCCAGCAGGTCAGCAAAGAAT160
KITCATGCACCAATGAAGGCGGTTCAGCCCGTGAGGGAGTAATT166
STRA8AGCCGTTTACTTTCACTCTGACCGCTGTTTGCATTCCCATCCT148