Skip to main content

Table 3 Nucleotide sequences of primers (tight junction proteins and growth factors) for quantitative real-time PCR1 assay

From: Dietary encapsulated essential oils and organic acids mixture improves gut health in broiler chickens challenged with necrotic enteritis

NamePrimer sequence (5´→3´)GenBank accession
Tight junctions
 Claudin-1F: AAGTGCATGGAGGATGACCANM_001013611.2
R: GCCACTCTGTTGCCATACCA
 OccludinF:TCATCGCCTCCATCGTCTACNM_205128.1
R:TCTTACTGCGCGTCTTCTGG
ZO-1F: TATGAAGATCGTGCGCCTCCXM_015278981.1
R: GAGGTCTGCCATCGTAGCTC
 Mucin-2F: AGCGAGATGTTGGCGATGATNM_001318434.1
R: AAGTTGCCACACAGACCACA
Growth factors
TGF-β3F:TGCGGCCAGATGAGCATNM_205454.1
R:TGCACATTCCTGCCACTGA
IGF-2F: TGGCTCTGCTGGAAACCTACNM_001030342.2
R: ACTTGGCATGAGATGGCTTC
EGFRF: ACCAGCCTGCAGAGAATGTANM_205497
R: CACCATGTTAAGCGCAATGA
GLP-2F:AAGCTTCCCAGTCTGAACCANM_205260.4
R:ATCCTGAGCTCGTCTGCTGT
House-keeping genes
 β-actinF: GAGAAATTGTGCGTGACATCANM 205518
R: CCTGAACCTCTCATTGCCA
  1. 1Primers were designed and synthesized by Sango Biotech (Shanghai) Co., Ltd. F: forward; R: reverse
  2. ZO-1 zonula occludens-1; EGFR epidermal growth factor receptor; GLP-2 glucagon-like peptide-2; IGF-2 insulin-like growth factor-2; TGF- β3 transforming growth factor beta 3