Skip to main content

Table 2 Nucleotide sequences of primers (TLR-mediated signaling pathway-related cytokines, chemokines and negative regulators) for quantitative real-time PCR1 assay

From: Dietary encapsulated essential oils and organic acids mixture improves gut health in broiler chickens challenged with necrotic enteritis

NamePrimer sequence (5' → 3')GenBank accession
ReceptorsTLR-2F: GGGGCTCACAGGCAAAATCNM_001161650.1
R: AGCAGGGTTCTCAGGTTCACA
TLR-4F:CCACTATTCGGTTGGTGGACNM_001030693.1
R:ACAGCTTCTCAGCAGGCAAT
Adaptor proteinsMyD88F:GGATGGTGGTCGTCATTTCANM_001030962.1
R:GAGATTTTGCCAGTCTTGTCCA
TRAF-6F: CACAGAGGAGACGCAGGGATAXM_001235884.1
R: AACAGATCGGGCACTCGTATTT
NF-kBF:TGGAGAAGGCTATGCAGCTTNM_205134.1
R:CATCCTGGACAGCAGTGAGA
Pro-inflammatory cytokinesTNFSF15F- CCAAGAGCACACCTGACAGTNM_001024578.1
R- CACAGGTATCACCAGTGCGT
IL-1βF-CAGCAGCCTCAGCGAAGAGNM_204524.1
R-CTGTGGTGTGCTCAGAATCCA
IL-8F-GGCTTGCTAGGGGAAATGAAJ009800
R-AGCTGACTCTGACTAGGAAACTGT
IFN-γF-AAAGCCGCACATCAAACACANM_205149.1
R-GCCATCAGGAAGGTTGTTTTTC
Ant-inflammatory cytokinesIL-10F:CGCTGTCACCGCTTCTTCANM_001004414.2
R:CGTCTCCTTGATCTGCTTGATG
Negative regulatorsTollipF:CATGGTACCTGTGGCAATACCNM_001006471
R:GCACTGAGCGGATTACTTCC
PI3KF:AACATCTGGCAAAACCAAGGNM_001004410
R:CTGCAATGCTCCCTTTAAGC
A20F:GAGAACGCAGAGCCTACACCNM_001277522.1
R:CCAACCTTCTTCCTGCACAT
SOCS-1F:GCTCTCAGGCTCGAGGTTACNM_001137648.1
R:GCTTGCTCGAGTGATGCTACT
SOCS-6F: CAGATATCTTTGTGGACCAGGCAGTGAANM_001127312
R: GGTAGCAAAGGTGAAAGTGGAGGGACATC
  1. 1Primers were designed and synthesized by Sango Biotech (Shanghai) Co., Ltd. F: forward; R: reverse
  2. TLR Toll-like receptor; MyD88 myeloid differential protein-88; TRAF-6 TNF receptor-associated factor 6; NF-κB nuclear factor kappa-light-chain-enhancer of activated B cells; TNFSF15 tumor necrosis factor superfamily member 15; IL interleukin; IFN-γ interferon γ; Tollip Toll-interacting protein; PI3K phosphatidylinositol 3-kinase; A20 protein A20; SOCS suppressor of cytokine signaling