Skip to main content

Table 1 Primers for gene expression analysis using real-time PCR

From: Early inoculation with caecal fermentation broth alters small intestine morphology, gene expression of tight junction proteins in the ileum, and the caecal metabolomic profiling of broilers

Gene namePrimer sequences (5′→3′)GenBank accessionExpected size, bp
ZO1F: CCACTGCCTACACCACCATCTC
R: CGTGTCACTGGGGTCCTTCAT
XM_015278975.1138
ZO2F: CCCAGTGGTTTCCCATTGTAGTC
R: GAACACAGCCTTTGTCTCATCGT
XM_015280242.179
CLDN1F: GCATGGAGGATGACCAGGTGA
R: GAGCCACTCTGTTGCCATACCAT
NM_001013611.2117
CLDN2F: CCTACATTGGTTCAAGCATCGTGA
R: GATGTCGGGAGGCAGGTTGA
NM_001277622.1131
GAPDHF: CAGAACATCATCCCAGCGTCCA
R: ACGGCAGGTCAGGTCAACAA
NM_204305.1135