Skip to main content

Table 2 Nucleotide sequences of primers used for MeDIP

From: Maternal betaine suppresses adrenal expression of cholesterol trafficking genes and decreases plasma corticosterone concentration in offspring pullets

Target genes Primer sequences (5′ to 3′) PCR products, bp
StAR
 Segment 1 F: CAGGGACACCTCGGTTCTTC 177
R: GCTGTTATCCCAATGGAGCG
 Segment 2 F: CTCGGGGTCTTTCATTGCCA 129
R: CAGGGAGCAGGCGATAAGAT
 Segment3 F: GGCGGTTTCTGTTCAGAGGT 160
R:: CAGAGCAACACCCCAAACAC
 Segment 4 F: GGCGGTTTCTGTTCAGAGGT 196
RACAGAGCAACACCCCAAACAC
CYP11A1
 Segment 1 F: TAAGGGCCGTGTTTTGGAGG 194
R: TGGGGACTCAGCAGATTTCG
 Segment 2 F: AACTGACAGCGTAATGCCCA 164
R: AAAGAGGGGGTTGGAAACGG
 Segment3 F: CAGGGTATGGGTTGCAGGTT 116
R: GTGGAAAACCCCCATCGTCT
CYP21A2 F: CTCAACGTGAGATCTGGGGG 148
R: TTGAAAGGTCCAGTTGGGGG
VIM
 Segment 1 F: GTGGGGACGCCGCTCTT 181
R: GGGTGCTGGACGTGATGTAG
 Segment2 F: GGGACGCCGCTCTTCTT 110
R: GAGGAGTTCTTGCTGCTGGT
SF-1
 Segment 1 F: CATTTACCCCCGCAAACACC 187
F: CTCTAGCAGGTTCAAGGTCCC
 Segment 2 F: TATCGCCAAAGTCCTCACCG 193
R: CTCCATCCACGCGGCTTATC
VDAC1 F: AAGTGATCTGCCTGTCTCGG 144
R: TTGAGGCTGGGAGCAAATGT