Skip to main content

Table 1 Nucleotide sequences of specific primers used for real-time PCR

From: Maternal betaine suppresses adrenal expression of cholesterol trafficking genes and decreases plasma corticosterone concentration in offspring pullets

Target genes GenBank accession Primer sequences (5′ to 3′) PCR products, bp
StAR NM_204686.2 F:ATGGCATCCAAGGAGTGA 103
R: GGGAGACAGAAGGGAACAG
CYP11A1 NM_001001756.1 F: AGCACTTCAAGGGACTGAGC 147
R:ACTTGGTCCCAACTTCCACC
3BHSD2 XM_417988.5 F: CTGGAAGAAGATGAGGCGCT 249
R: ACCTGTCACGTTGACTTCCC
CYP21A2 >NM_001099358.1 F: CTTTGAGGCGTTCACGTTCC 169
R: CTGGGACTCCACAAAGGCAT
CYP19A1 NM_001364699.1 F: CATGCACCCAATAGAAAGGCA 130
R: GCATTTCTTAAAGTGACTGCAAAC
CYP17A1 NM_001001901.2 F: TCTGCTCCCTCTGCTTCAA 250
R: AGGTCCCTCACAGTGTCCC
SF-1 XM_015279334.1 F: TCTTCCTGAATTTCCCTT 151
R: TGAACATCCCATCTAGTGA
CREB XM_015294628.2 F: GTCAGACACACCAGAGCCTT 128
R: CATTCCTGCTCCCCTTCCTC
BHMT XM_414685.3 F: CGAGTGGGACGGCTTCTT 144
R: AGGCGATAGGTGTCAGGGA
AHCYL1 NM_001030913.1 F:TGGTGTTGTTGGGGGAGAT 227
R:CCCCATCAATACTCATCCAAC
DNMT1 NM_206952.1 F:TGATAYGTTGGATGAGTATTGATGG 264
R: AAAAAAACTCTCACTCAACTCCAC
GNMT1 XM_015283546.1 F: GGAGGAGGGCTTCCAAGTGA 140
R: GCTCCAGCGTCAGCCAGTT
VIM AH002482.2 F: CTTTGCCCAGTGCTGTAGTC 171
R: AAACACGGGCTGTCAGTCA
VDAC1 NM_001033869.2 F: GAACAGGGACGGGGACAG 136
R: CAGACTTGCCCAGATCAGCA