Skip to main content

Table 1 Primer sequences of target and reference genes

From: Enterococcus faecium NCIMB 10415 administration improves the intestinal health and immunity in neonatal piglets infected by enterotoxigenic Escherichia coli K88

Gene Primer sequence (5'→3') Product, bp GenBank accession
TLR-9 Forward: AATCCAGTCGGAGATGTTTGCT 79 AY859728
Reverse: GACCGCCTGGGAGATGCT
TLR-2 Forward: TCGAAAAGAGCCAGAAAACCAT 58 NM213761
Reverse: CTTGCACCACTCGCTCTTCA
TLR-4 Forward: AGAAAATATGGCAGAGGTGAAAGC 64 GQ304754
Reverse: CTTCGTCCTGGCTGGAGTAGA
MyD88 Forward: GTGCCGTCGGATGGTAGTG 65 NM001099923
Reverse: TCTGGAAGTCACATTCCTTGCTT
TRAF-6 Forward: GCTGCATCTATGGCATTTGAAG 70 AJ606305.1
Reverse: CCACAGATAACATTTGCCAAAGG
NF-κB Forward: TGCTGGACCCAAGGACATG 60 AK348766.1
Reverse: CTCCCTTCTGCAACAACACGTA
IL-6 Forward: GATGCTTCCAATCTGGGTTCA 62 M80258.1
Reverse: CACAAGACCGGTGGTGATTCT
Claudin-1 Forward: TCTTAGTTGCCACAGCATGG 106 NM001244539
Reverse: CCAGTGAAGAGAGCCTGACC
Occludin Forward: TTCATTGCTGCATTGGTGAT 113 NM001163647
Reverse: ACCATCACACCCAGGATAGC
ZO-1 Forward: CCGCCTCCTGAGTTTGATAG 97 AJ318101
Reverse: CAGCTTTAGGCACTGTGCTG
β-actin Forward: GGCGCCCAGCACGAT 66 DQ845171.1
Reverse: CCGATCCACACGGAGTACTTG
  1. TLR Toll-like receptor, MyD88 myeloid differentiation factor 88, TRAF-6 TNF receptor-associated factor 6, NF-κB nuclear transcription factor kappa B, IL interleukin, ZO-1 zonula occludens-1