Skip to main content

Advertisement

Table 2 Primers used for Real-time PCR

From: Transcriptome analysis of the effect of pyrroloquinoline quinone disodium (PQQ·Na2) on reproductive performance in sows during gestation and lactation

Genes Primer sequence (5′→3′) Product size, bp GenBank No.
GAPDH F: ATGGTGAAGGTCGGAGTGAA R: CCGTGGGTGGAATCATACTG 155 NM_001206359.1
SOD1 F: TCCATGTCCATCAGTTTGGA R: AGTCACATTGCCCAGGTCTC 131 NM_001190422.1
IL-6 F: AGCAAGGAGGTACTGGCAGA R: GTGGTGGCTTTGTCTGGATT 257 NM_001252429.1
IL-8 F: ACTTCCAAACTGGCTGTTGC R:GGAATGCGTATTTATGCACTGG 120 NM_213867.1
NOS2 F: CGTTATGCCACCAACAATGG R: GTGCCATCAGGCATCTGGTA 134 NM_001143690.1
CDX2 F: GTCGCTACATCACCATTCGG R: GATTTTCCTCTCCTTCGCTCT 110 NM_001278769.1
CCN1 F: TCGGCAGCCTGAAAA AGGGCA R: TCGCAGCGGAAGCGCATCTT 122 NM_001012022.1
GCLC F: GCATGTGGCTCACCTCTTCATCAG R: GGAGGCTTGAATCTCATCGTCTGC 135 XM_021098556.1
CALM F: GCTCATCGCCAGAGTGGACAAG R: GCCTGCATCACCGTGACCATG 84 XM_005668226.3
  1. IL-6 interleukin 6; IL-8 interleukin 8; SOD1 superoxidedismutase 1; NOS2 nitric oxide synthase 2; CDX2 caudal type homeobox 2; CCN1 cellular communication network factor 1; GCLC glutamate-cysteine ligase catalytic subunit; CALM calmodulin