Skip to main content

Advertisement

Table 2 Primers sequences used for quantitative RT-PCR

From: Differential expression, molecular cloning, and characterization of porcine beta defensin 114

Gene Accession No. Primer sequences (5′→3′) Product length, bp
β-actin XM_003124280.5 TGGAACGGTGAAGGTGACAGC 177
GCTTTTGGGAAGGCAGGGACT
TNFα NM_214022.1 GCATCGCCGTCTCCTACCAG 173
GGGCAGGTTGATCTCGGCAC
PBD114 NM_001129973.1 TTGGTGGATCCTGAACGATGCT 130
CTTCTTCAAACGCCCTCTGAATGC