Skip to main content

Table 2 Sequences and accession numbers of oligonucleotide primers used for real-time PCR and the length of the PCR products

From: Prepartum body conditions affect insulin signaling pathways in postpartum adipose tissues in transition dairy cows

Gene name Oligonucleotide sequences (5’to3’) of primers GenBank accession number Product length, bp
GAPDH F: CCACGTTGTAGCCGACATC NM001034034 201
R: CCCTGAAGAGGACCTGTGAG
β-actin F: CACCGCAAATGCTTCTAGGC NM_173979.3 186
R: TGTCACCTTCACCGTTCCAG
HPRT F: GACCAGTCAACAGGCGACAT NM_001034035.2 130
R: TGACCAAGGCAAGCAAAGTC
INSR F: AGGAGCTGGAGGAGTCCTCGTTCA XM005208817.2 147
R: CATTCCCCACGTCACCAAGGGCTC
GLUT4 F: TTCATTGGCGCCTACTCAGG NM174604.1 142
R: CTAGCACCTGGGCGATTAGG
TNFα F: CCACGTTGTAGCCGACATC NM173966 155
R: CCCTGAAGAGGACCTGTGAG
PPARγ F: ACTTTGGGATCAGCTCCGTG NM181024.2 137
R: GTCAGCTCTTGGGAACGGAA
  1. GAPDH Glyceraldehydes 3-phosphate dehydrogenase, HPRT Hypoxanthine phosphoribosyl-transferase, INSR insulin receptor, GLUT4 Glucose transporter 4, TNFα Tumor necrosis factor-alpha, PPARγ Peroxisome proliferator-activated receptor gamma