Skip to main content

Table 2 Primer sequences for the mRNA expression analysis of genes

From: Effects of restrictions on maternal feed intake on the immune indexes of umbilical cord blood and liver Toll-like receptor signaling pathways in fetal goats during pregnancy

Gene name Primers (5′ to 3´) Length, bp
ActinB (β-actin) F: ATGGCTACTGCTGCGTCGT
R: TTGAAGGTGGTCTCGTGGAT
161
Toll-like receptor 2 (TLR2) F: ACGACGCCTTTGTGTCCTAC
R: GGGACGAAGTCTCGCTTATG
121
Toll-like receptor 3 (TLR3) F: ATTGGGCAAGAACTCACAGG
R: AGGCTTGGAACTGAGGTGAA
119
Toll-like receptor 4 (TLR4) F: ACTCCCTCCCTAGCCTTCAG
R: GCCGTGATACGGTTGAAACT
124
Toll-like receptor 7 (TLR7) F: GTTCCATTTCCTTGCACACC
R: GGGCACATGCTGAAGAGAGT
123
Myeloid differentiation primary response 88 (MyD88) F: GAGGACGTGCTGATGGAACT
R: CGAGGGATGCTGCTGTCTAT
125
Interleukin-1 receptor-associated kinase 1 (IRAK1) F: GACACCGACACCTTCAGCTT
R: TGCCTCCTCTTCAACCAAGT
117
TNF receptor associated factor 6 (TRAF6) F: CAGCAGTGCAATGGGATTTA
R: CCGGGTTTGCCAGTATAGAA
119
Toll like receptor adaptor molecule 1 (TRIF) F: ACTTCTCACAGGCACCACCT
R: GGTCCCTCTCTGATTCCACA
119
TANK-binding kinase 1 (TBK1) F: TGATCACGTTGGATTTCTGC
R: GCTTGGTGCGTATGTCTGAA
120
Nuclear factor kappa B subunit 1 (NFKB1) F: GTGCTCGGTGGGAGTAAGAG
R: CTCCCGTCACTGCATAGTCA
119
NFKB inhibitor alpha (NFKB1A) F: CTACACCTTGCCTGTGAGCA
R: CACGTGTGGCCATTGTAGTT
116
Interferon regulatory factor 3 (IRF3) F: GACCAGCCATGGATCAAGAG
R: CAGGTCGACAGTGTTCTCCA
117
Interferon regulatory factor 7 (IRF7) F: TGGCAGCAGATACTGGTGAG
R: GAAGATGGTCCTCCAAGCAG
129
Interferon beta (IFN-β) F: CCATCATTGAGCACCTCCTT
R: AGGTGAAGATCGGTCGTGTC
118
Interferon gamma (IFN-γ) F: GAACGGCAGCTCTGAGAAAC
R: ATTTTGGCGACAGGTCATTC
125
Transforming Growth factor beta 1 (TGF-β) F: GAACTGCTGTGTTCGTCAGC
R: TCCAGGCTCCAGATGTAAGG
126
Tumor necrosis factor (TNF-α) F: CCACTGACGGGCTTTACCT
R: TGATGGCAGAGAGGATGTTG
141
Interleukin 1 beta (IL-1β) F: AAGCCTCTCCACCTCCTCTC
R: TTGTCCCTGATACCCAAGG
114
Interleukin 2 (IL-2) F: GTGAAGTCATTGCTGCTGGA
R: GCGTTAACCTTGGGCATGTA
113
Interleukin 4 (IL-4) F: CATCCTCACATCGCAGAAGA
R: ACGCCTAAGCTCAATTCCAG
118
Interleukin 6 (IL-6) F: TGACTTCTGCTTTCCCTACCC
R: GCCAGTGTCTCCTTGCTGTT
193
Interleukin 10 (IL-10) F: GCTGTTGCCTGGTCTTCCT
R: TGTTCAGTTGGTCCTTCATTTG
178