Skip to main content

Advertisement

Table 2 Primers used for quantitative real-time PCR

From: Influence of starch sources and dietary protein levels on intestinal functionality and intestinal mucosal amino acids catabolism in broiler chickens

Gene name Accession number Forward sequence (5′ to 3′) Reverse sequence (5′ to 3′)
β-actin NM_205518 GAGAAATTGTGCGTGACATCA CCTGAACCTCTCATTGCCA
mTOR XM_417614.5 GAAGTCCTGCGCGAGCATAAG TTTGTGTCCATCAGCCTCCAGT
GLUT2 Z22932 CCGCAGAAGGTGATAGAAGC ATTGTCCCTGGAGGTGTT
SGLT1 XM_415247 AGATTTGGAGGGCAGAGGAT GCCCAAAGAGATTTGGATGA
PepT1 AY029615 TACGCATACTGTCACCATCA TCCTGAGAACGGACTGTAAT
APN NM_204861 GATCCACAGCAACAAGCTGA TACTGCGTGTTGGTCTCCAG
rBAT XM_426125 AAGGAGCTGAAGGGCTTACC ATTTCATCTTGGCTGCTGGT
ATB 0,+ XM_426267 CCTGCTCATCTTGTTGGTGA GCATCTTTCCAAACCTCTGC
B 0 AT1 XM_419056 TATCCTGGCTGGGTCTATGC AGGCCTGTACGATCCCTTCT
EAAT3 XM_424930 TGATTGTTCTGAGCGCTGTC TACCAAAGGCATCTCCCAAG
CAT1 XM_417116 CACATGGATACGGTTTGCAG GTCCATGCTTCTCTCCGTGT
y + LAT1 XM_418326 CACCAGTCCCTGCTCTTCTC CTGCAATAGACAAGCCCACA
LAT1 CD217821 TACCTGCTGAAGCCCATCTT ACGGGTAGCAGCTTTCACAC
CASP-3 NM_204725.1 ACACGCCAGGAAACTTGAAC ACACGCCAGGAAACTTGAAC