Skip to main content

Advertisement

Table 3 Sequences of chNHE1, tvb, and tva-modified DF-1 clones

From: Sequential disruption of ALV host receptor genes reveals no sharing of receptors between ALV subgroups A, B, and J

ID Sequence (5′→3′) Indel
WT
chNHE1 CCGACGCCACGCGTGTCTCCGAGCCCACCTGGGAGCAGCCGTGGGGAGAGCCCGGGGGTATCACCGCC WT
tvb AAAGACGAGTACACCGAGTATCCAAATGACTTTCCCAAGTGCCTGGGCTGCCGGACGTGTAGGGAAGGTAT WT
tva TGCTACCCGCTGGAGTGGCTCTGCGACGGGCATCCCGACTGCGACGATGGACGGGACGAGTGGGGCTGCG WT
N3Pss#12
chNHE1 −3 bp, T96G
tvb AAAGACGAGTACACCGAGTATCCAAATGACTTTCCCAAGTGCCTGGGCTGCCGGACGTGTAGGGAAGGTAT WT
tva TGCTACCCGCTGGAGTGGCTCTGCGACGGGCATCCCGACTGCGACGATGGACGGGACGAGTGGGGCTGCG WT
N3Pss#12 + TVB#2
chNHE1 −3 bp, T96G
tvb −8 bp
tva TGCTACCCGCTGGAGTGGCTCTGCGACGGGCATCCCGACTGCGACGATGGACGGGACGAGTGGGGCTGCG WT
N3Pss#12 + TVB#2 + TVA#1–6
chNHE1 −3 bp, T96G
tvb −8 bp
tva −46 bp
N3Pss#12 + TVB#2 + TVA#1–8
chNHE1 −3 bp, T96G
tvb −8 bp
tva −4 bp
N3Pss#12 + TVB#2 + TVA#4–8
chNHE1 −3 bp, T96G
tvb −8 bp
tva −6 bp
  1. Underling indicates guide RNA recognition sites and protospacer-adjacent motif sequences
  2. Strikethroughs indicate deleted nucleotides and italicized bold letters indicate modified mutations