Skip to main content

Advertisement

Table 2 Sequences of tva-modified DF-1 clones

From: Sequential disruption of ALV host receptor genes reveals no sharing of receptors between ALV subgroups A, B, and J

ID Sequence (5′→3′) Indel
WT TGCTACCCGCTGGAGTGGCTCTGCGACGGGCATCCCGACTGCGACGATGGACGGGACGAGTGGGGCTGCG WT
TVA#1–2 1 modif/
− 6 bp
TVA#1–5 −3 bp
TVA#1–6 TGCTACCCGCTGGAGTGGCTCTGCGACGGGCATCCCGACTGCGACGATGGACGGGAcCGAGTGGGGCTGCG + 1 bp
TVA#1–7 −42 bp
TVA#1–8 −16 bp
TVA#4–2 TGCTACCCGCTGGAGTGGCTCTGCGACGGGCATCCCGACTGCGACGATGGACGGGACGAGTGGGGCTGCG WT
TVA#4–4 −13 bp
TVA#4–9 TGCTACCCGCTGGAGTGGCTCTGCGACGGGCATCCCGACTGCGACGATGGACGGGACGAGTGGGGCTGCG WT
  1. Underlining indicates guide RNA recognition sites and protospacer-adjacent motif sequences
  2. Strikethroughs indicate deleted nucleotides and the lowercase letter indicates an inserted nucleotide. The italicized bold letter indicates a modified mutation