Skip to main content

Advertisement

Table 1 Oligos used in the study

From: Sequential disruption of ALV host receptor genes reveals no sharing of receptors between ALV subgroups A, B, and J

Oligo ID Sequence (5′→3′)
TVA#1 F CACCGGCGACGATGGACGGGACGAG
TVA#1 R AAACCTCGTCCCGTCCATCGTCGCC
TVA#4 F CACCGCGCTGGAGTGGCTCTGCGAC
TVA#4 R AAACGTCGCAGAGCCACTCCAGCGC
TVA seq F ACACTGACAGCGAGGCGTGC
TVA seq R ACCTCTCCGCACGACGTTCT
wtTVA F AAGCTTCCGGCGGGCCCGGGGCCGGCATG
wtTVA R GCGGCCGCAGGCAAAAAGAGTGAGGGAATTCC
mutaTVA(+ 1) F CTGCGACGATGGACGGGACCGAGTGGGGCTGCGGAGCGAG
mutaTVA(+ 1) R CTCGCTCCGCAGCCCCACTCGGTCCCGTCCATCGTCGCAG
mutaTVA(−3) F CGACTGCGACGATGGACGGGAGTGGGGCTGCGGAGCGAGC
mutaTVA(−3) R GCTCGCTCCGCAGCCCCACTCCCGTCCATCGTCGCAGTCG
mutaTVA(∆1–6) F ATCCCGACTGCGACGATGGAAAGTGGGGCTGCGGAGCGAG
mutaTVA(∆1–6) R CTCGCTCCGCAGCCCCACTTTCCATCGTCGCAGTCGGGAT