Skip to main content

Table 4 Sense and anti-sense primer sequences (5′→3′) used in qRT-PCR analysis

From: Dietary arachidonate in milk replacer triggers dual benefits of PGE2 signaling in LPS-challenged piglet alveolar macrophages

Target GenBank accession Amplicon size, bp Primer sequence
RPL4 XM_005659862.3 110 F: TTCAAGGCTCCCATTCGACC
R: GCACTGGTTTGATGACCTGC
RPL9 XM_013978597.2 106 F: GGGTTGACAAATGGTGGGGA
R: TTGTAACGGAAGCCCAGTGT
SDHA XM_021076931.1 106 F: TTGCGAACGGAACCATAAGGA
R: CAGCCTTCCTGTAACACGCT
YWHAZ XM_001927228.7 105 F: AAGAAGGGGATTGTGGATCAGTC
R: AAGGGCCAGACCCAATCTGA
TLR-4 NM_001113039.2 112 F: CGTGCAGGTGGTTCCTAACA
R: CAGGTAGTTAAAGCTCAGGTCCA
COX-1 XM_001926129.6 116 F: ACACGGCACACGACTACATC
R: CTTCTTCCCTTTGGTCCCCAT
COX-2 NM_214321.1 90 F: ATGGGTGTGAAAGGGAGGAAAG
R: CTGGGGATCAGGGATGAACTT
5-LOX XM_021072736.1 103 F: ATGCCAAATGCCACAGGGAT
R: ATGAACAGGTTCTCCATCGCTT
12/15-LOX [90] NM_213931 97 F: CAGGCTTGGTGTCGAGAGTT
R: AGTGGCAGAGCTGTTCCTTG
TNF-α NM_214022.1 94 F: CCCCAGAAGGAAGAGTTTCCA
R: CGACGGGCTTATCTGAGGTTT
IL-6 NM_001252429.1 101 F: GACCCTGAGGCAAAAGGGAA
R: TCCACTCGTTCTGTGACTGC
IL-10 [91] NM_214041.1 101 F: GACGTAATGCCGAAGGCAGA
R: AGGGCAGAAATTGATGACAGCG