Skip to main content

Advertisement

Table 2 Primers for qPCR assay

From: Effects of urea plus nitrate pretreated rice straw and corn oil supplementation on fiber digestibility, nitrogen balance, rumen fermentation, microbiota and methane emissions in goats

Microbial Species Primer Sets (5′→3′) Product size, bp References
Protozoa F: GCTTTCGWTGGTAGTGTATT;
R: CTTGCCCTCYAATCGTWCT
223 [47]
Fungi F:GAGGAAGTAAAAGTCGTAACAAGGTTTC;
R:CAAATTCACAAAGGGTAGGATGATT
121 [48]
Bacteria F: CGGCAACGAGCGCAACCC;
R: CCATTGTAGCACGTGTGTAGCC
146 [48]
Methanogens F: GGATTAGATACCCSGGTAGT;
R: GTTGARTCCAATTAAACCGCA
192 [49]
Selected groups of bacteria
Fibrobacter succinogenes F:GTTCGGAATTACTGGGCGTAAA;
R: CGCCTGCCCCTGAACTATC
121 [48]
Ruminococcus albus F:CCCTAAAAGCAGTCTTAGTTCG;
R: CCTCCTTGCGGTTAGAACA
176 [50]
Ruminococcus flavefaciens F: GAACGGAGATAATTTGAGTTTACTTAGG;
R: CGGTCTCTGTATGTTATGAGGTATTACC
132 [48]
Selenomonas ruminantium F: CAATAAGCATTCCGCCTGGG;
R: TTCACTCAATGTCAAGCCCTGG
138 [51]