Skip to main content

Advertisement

Table 3 Primer sequences used for quantitative RT-PCR analyses

From: Neonatal vitamin A injection promotes cattle muscle growth and increases oxidative muscle fibers

Gene name Accession no. Product size, bp Direction Sequence (5′→3′)
PAX3 NM_001206818.1 200 Forward AGTGAGTTCCATCAGCCGCATC
Reverse TCTTCAGGGGCAAGTCTGGTTC
PAX7 XM_015462509.1 107 Forward CGGGCATGTTTAGCTGGGAGA
Reverse TCTGAGCACTCGGCTAATCGAAC
MYOD NM_001040478.2 111 Forward GAACTGCTACGACCGCACTTACT
Reverse GAGATGCGCTCCACGATGCT
MYF5 XM_015470879.1 93 Forward CCCACCAGCCCCACCTCAAGT
Reverse GTAGACGCTGTCAAAACTGCTGCT
MYOG NM_001111325.1 131 Forward CTCAACCAGGAGGAGCGCGAC
Reverse TTGGGGCCAAACTCCAGTGCG
18S NR_036642.1 118 Forward CCTGCGGCTTAATTTGACTC
Reverse AACTAAGAACGGCCATGCAC
PGC1A NM_177945.3 200 Forward TGATTAGTTGAGCCCTTGCCG
Reverse TGCCAGGAGTTTGGTTGTGAT