Skip to main content

Advertisement

Table 2 Primer sequences of housekeeping and target genes

From: Ascorbic acid synthesis and transportation capacity in old laying hens and the effects of dietary supplementation with ascorbic acid

Genes Prime sequencea NCBI number Product size, bp
GAPDH Fb GACCCCAGCAACATCAAATG NM_204305.1 110
R TTAGCACCACCCTTCAGATG
GLO F TCTCCTCTGGATCAGCACCT XM_015285218.1 131
R AGCGGCACTCGTAGTTGAAG
SVCT1 F GGGATACCCACGGTGACCTC XM_004944768.2 100
R GCCGTGCACAGGAGTAGTAA
SVCT2 F TGTCTTGTGCTCCTCCTCCT NM_001145227.1 101
R TCCATTCCCTGTCCCAAATA
GLUT1 F TAGTACTGGAGCAGGTGGCAGA NM_205209.1 124
R CGGCACAAGAATGGATGAAA
GLUT3 F TGCTGATAATTGGGCGCTTC NM_205511.1 150
R CCACCAGGATGCCTACAACT
TXN F GATTTCTCTGCCACATGGTGT NM_205453.1 117
R ATCTTGGGCATCATCCACAT
TXNR F GCTTCCTATGTTGCCTTGGA NM_001030762.2 112
R TGTTTGCCATATCCTGGTCA
CYB5R F GTGGATCACGTTCTGGGTCT NM_001291805.1 119
R ACGAAGCCCTTGTCATCATC
  1. a Primer sequences are displayed in the 5′ → 3′ direction
  2. b F forward primer, R reverse primer