Skip to main content

Advertisement

Table 1 Primers used for 5′ and 3′ RACE

From: Molecular cloning and characterization of the endothelin 3 gene in black bone sheep

Primer name Sequences (5′→3′) Ta, °C PCR
5´ Gene specific primer ACCGTCTCCTTGGTGTCCCCCTCCGAT 65 Normal - kit protocol
5´ Gene specific nested primer ATCCTGCGGCGGAGGTCACAGCGAG 75 Touchdown
3´ Gene specific primer GCTGAGGTGTTAGCCTTGACCAAATGC 65 Normal - kit protocol
3´ Gene specific nested primer TGGAAAGGACTGATGTGCCAGCGAGAT 75 Touchdown