Skip to main content

Advertisement

Table 2 Primers used for relative real-time PCRa

From: Effects of dietary phosphorous supplementation on laying performance, egg quality, bone health and immune responses of laying hens challenged with Escherichia coli lipopolysaccharide

Gene Primer sequence (5′ → 3′) b GenBank accession no.
GAPDH F: GGTGGAGGAATGGCTGTCA NM_204305
R: CCTAGGATACACAGAGGACCAGGTT
IL-1β F: ACTGGGCATCAAGGGCTA HM179638
R: GGTAGA AGATGA AGCGGGTC
IL-6 F: TTTATGGAGAAGACCGTGAGG HM179640
R: TGTGGCAGATTGGTAACAGAG
IL-10 F: GCTGTCACCGCTTCTTCACCT EF554720.1
R: GGCTCACTTCCTCCTCCTCATC
  1. GAPDH Glyceraldehyde-3-phosphate dehydrogenase, IL-1β Interleukin-1 beta, IL-6 Interleukin-6, IL-10 Interleukin 10
  2. aPrimers designed by Primer Express software (Applied Biosystems, Foster City, CA)
  3. bF Forward, R reverse