Skip to main content

Advertisement

Table 3 Primer pairs for host genes

From: Ileum terminal antibiotic infusion affects jejunal and colonic specific microbial population and immune status in growing pigs

Genea Forward primer, 5′→3’ Reverse primer, 5′→3’ Reference Annealing temp, °C
β-actin AGAGCGCAAGTACTCCGTGT ACATCTGCTGGAAGGTGGAC [70] 60
TLR2 TCACTTGTCTAACTTATCATCCTCTTG TCAGCGAAGGTGTCATTATTGC [71] 60
TLR4 TCAGTTCTCACCTTCCTCCTG GTTCATTCCTCACCCAGTCTTC [72] 60
TLR5 CAGCGACCAAAACAGATTGA TGCTCACCAGACAGACAACC [71] 60
IL-8 ACTGGCTGT TGCCTTCTT CAGTT CTCTTCAAAAATATCTG [73] 60
IL-10 GTCCGACTCAACGAAGAAGG GCCAGGAAGATCAGGCAATA [70] 60
IFN-γ TCCAGCGCAAAGCCATCAGTG ATGCTCTCTGGCCTTGGAACATAGT [74] 60
TNF-α CCACGCTCTTCTGCCTACTGC GCTGTCCCTCGGCTTTGAC [73] 60
MUC1 GGTACCCGGCTGGGGCATTG GGTAGGCATCCCGGGTCGGA [70] 60
MUC2 CTGCTCCGGGTCCTGTGGGA CCCGCTGGCTGGTGCGATAC [70] 60
OCLN ATGCTTTCTCAGCCAGCG TA AAG GTTCCATAGCCTCGGTC [73] 60
ZO-1 GAGGATGGTCACACCGTGGT GGAGGATGCTGTTGTCTCGG [73] 60
  1. aTLR2 toll-like receptor2, TLR4 toll-like receptor 4, TLR5 toll-like receptor 5, IL-8 interleukin-8, IL-10 interleukin-10, IFN-γ interferon-γ, TNF-α tumor necrosis factor-α, ZO-1 zonula occludens-1, MUC1  mucin-1; MUC2  mucin-2; OCLN  occludin