Skip to main content

Advertisement

Table 1 Primers used in real-time PCR

From: Gene expression of CCL8 and CXCL10 in peripheral blood leukocytes during early pregnancy in cows

Genes   Sequence (5′→3′) GenBank accession number Size, bp
CCL8 Forward AACATGAAGGTCTCCGCTGG NM_174007 108
Reverse GCAGCAGGTGATTGGGGTAG   
CXCL10 Forward CTCGAACACGGAAAGAGGCA NM_001046551 117
Reverse TCCACGGACAATTAGGGCTT   
ISG15 Forward GCAGACCAGTTCTGGCTGTCT NM_174366 58
Reverse CCAGCGGGTGCTCATCAT   
MX1 Forward GAGGTGGACCCCCAAGGA NM_173940 58
Reverse CCACCAGATCGGGCTTTGT   
MX2 Forward GGGCAGCGGAATCATCAC NM_173941 55
Reverse CTCCCGCTTTGTCAGTTTCAG   
GAPDH Forward ACCCAGAAGACTGTGGATGG U85062 158
Reverse CAACAGACACGTTGGGAGTG