Skip to main content

Advertisement

Table 2 Species-specific primers for the quantification of selected rumen bacterial populations using a real-time qPCR assay

From: Association of residual feed intake with abundance of ruminal bacteria and biopolymer hydrolyzing enzyme activities during the peripartal period and early lactation in Holstein dairy cows

Target bacterial species   Primer sequence (5` → 3`) Reference Efficiencya, %
Anaerovibrio lipolytica F:b R:c GAAATGGATTCTAGTGGCAAACG ACATCGGTCATGCGACCAA [13] 96.06
Butyrivibrio proteoclasticus F: R: GGGCTTGCTTTGGAAACTGTT CCCACCGATGTTCCTCCTAA [13] 100.00
Eubacterium ruminantium F: R: CTCCCGAGACTGAGGAAGCTTG GTCCATCTCACACCACCGGA [53] 106.08
Fibrobacter succinogenes F: R: GCGGGTAGCAAACAGGATTAGA CCCCCGGACACCCAGTAT [53] 100.67
Megaspheara elsdenii F: R: AGATGGGGACAACAGCTGGA CGAAAGCTCCGAAGAGCCT [53] 101.35
Prevotella bryantii F: R: AGCGCAGGCCGTTTGG GCTTCCTGTGCACTCAAGTCTGAC [53] 105.03
Selenomonas ruminantium F: R: CAATAAGCATTCCGCCTGGG TTCACTCAATGTCAAGCCCTGG [53] 97.91
Succinimonas amylolytica F: R: CGTTGGGCGGTCATTTGAAAC CCTGAGCGTCAGTTACTATCCAGA [54] 96.80
Streptococcus bovis F: R: TTCCTAGAGATAGGAAGTTTCTTCGG ATGATGGCAACTAACAATAGGGGT [53] 103.89
Succinivibrio dextrinosolvens F: R: TAGGAGCTTGTGCGATAGTATGG CTCACTATGTCAAGGTCAGGTAAGG [54] 96.80
Eubacterial primer 1 F: R: GGATTAGATACCCTGGTAGT CACGACACGAGCTGACG [27] 95.26
Eubacterial primer 2 F: R: GTGSTGCAYGGYTGTCGTCA ACGTCRTCCMCACCTTCCTC [26] 95.30
Eubacterial primer 3 F: CCTACGGGAGGCAGCAG [29] 99.30
  R: ATTACCGCGGCTGCTGG   
  1. aMeasured efficiencies of the primers in the qPCR reactions
  2. bForward primer
  3. cReverse primer