Skip to main content

Advertisement

Table 3 Primers for the genes of AA transporters

From: Regulation of amino acid transporters in the mammary gland from late pregnancy to peak lactation in the sow

Gene name Gene accession Primers sequence (5′→3′) Size, bp
SLC1A1 NM_001164649 F: TCCACTCCATTGTTATTCTGCC 172
R: TTGTCCACCTGGTTCTTCTCTTC
SLC1A2 HSU03505 F: AGCAGGTGGAAGTGCGAATG 160
R: CGAAGAAGCCCTCCACACACT
SLC1A3 BC037310 F: TCACGCAGTCATCGTCTTGC 171
R: TTGTCCACGCCATTGTTCTC
SLC1A4 XM_003125088 F: AGACCTCTCTTTGATCCTGGC 190
R: TGTTTCCTCCTCTGATTTGCA
SLC1A5 XM_003127237 F: AAGGAGTCGGTTCTGTGATGG 108
R: TAAAAGTCGGCGAGGGTGA
SLC3A1 EU587017 F: TGCATGACATTGTCCGCAG 140
R: TTGGATAAAAGGCAACCCG
SLC3A2 XM_003353809 F: TGAACAGCAGCGTGACTGTG 162
R: ACTGGCGGATGTAGGAGAAGA
SLC6A14 GQ387269 F: TCCAGAAGCTCTAGCCCAACT 190
R: CAAAACCAAGCAGCAACCC
SLC6A15 NM_018057 F: GCTTCTTGGGCTTTGTGATG 232
R: GGTGAGTCCGTGCTTGTTTC
SLC7A1 NM_001012613 F: GCCTGAGAGCAAGACCAAAC 166
R: GCCGTAGCCGAAGTAGATGA
SLC7A2 EU155140 F: GCCCCAGAATCAGCAAAAAGTA 97
F: GATGCTGAAGGCTGGCAAAA
SLC7A5 NM_003486 F: CTCTTCCTGATCGCCGTCTC 165
R: CTTCTGACACAGGACGGTCGT
SLC7A6 NM_003983 F: CTGCCGCCTGCATGTGT 78
R: TGTGCCCCACTTGACATAGG
SLC7A7 EU047705 F: TTTGGTTCCCAAGGTTGCA 95
R: GCAGCTTCCTGGCATTGC
SLC7A8 AF135830 F: TCGCTGTGACTTTTGGAGAGA 112
R: CGGGAGGAGGTGAAGAGG
SLC7A10 XM_003127014 F: TGGACCCTCGAAAGAACCTAC 216
R: TGATCCCTCCGAAAGTGGA
SLC7A11 AB271957 F: AATGTGGCCTACTTCACGACC 193
R: CCTCCCGAGATGCAACATAGA
SLC38A1 XM_003355629 F: AAGAACCTGGGCTATCTCGG 138
R: TGTTGCGTTAGGACTCGTTG
SLC38A2 NM_018976 F: GTTACCTTTGGTGATCCAGGC 96
R: ACCAATGACACCAGCAGAACC
SLC38A4 XM_003355630 F:GTTCTTTGCCTTCACTCACTA 186
R: GACCCAAGCCTCCAGATT
MRPL39 AY610067 F: CAAAAGAGAACCTACATTCCTTCACA 100
R: TCTAATGCCACTTTTGCTTCAACT