Skip to main content

Advertisement

Table 2 Primers used for Real-time PCR

From: Dietary resveratrol improves antioxidant status of sows and piglets and regulates antioxidant gene expression in placenta by Keap1-Nrf2 pathway and Sirt1

Genes Sequence (5’to3’) Product size, bp GenBank No.
GPX4 F: CACCCTCTGTGGAAGTGGAT 112 NM_214407.1
R: TCACCACACAGCCGTTCTTA
GPX1 F: AAATGCTCACCCGCTCTTC 118 NM_214201.1
R: GTCATTGCGACACACTGGAG
CAT F: ACGCCTGTGTGAGAACATTG 124 NM_214301.2
R: GTCCAGAAGAGCCTGAATGC
SOD3 F: ACGCTGCTCTGTGCTTACCT 135 NM_001078688.1
R: CTGCCAGATCTCCGTCACTT
SOD2 F: TGGAGGCCACATCAATCATA 113 NM_214127.2
R: TTTCGAAGGAACCAAAGTCG
SOD1 F: TCCATGTCCATCAGTTTGGA 131 NM_001190422.1
R: AGTCACATTGCCCAGGTCTC
GAPDH F: ATGGTGAAGGTCGGAGTGAA 155 NM_001206359.1
R: CCGTGGGTGGAATCATACTG
NQO1 F: CCAGCAGCCCGGCCAATCTG 160 NM_001159613.1
R: AGGTCCGACACGGCGACCTC
HO1 F: AGGCTGAGAATGCCGAGTTC 90 NM_001004027.1
R: TGTGGTACAAGGACGCCATC
CYP1A1 F: CTGCCATCTTCTGCCTTGTA 314 NM_214412.1
R: GCTCTGGCCATTAGAGATCA
TXNRD1 F: CTTTACCTTATTGCCCGGGT 162 NM_214154.2
R: GTTCACCGATTTTGTTGGCC
GCLM F: CTTGCCTCTTGCTGTGTGAT 159 XM_001926378.4
R: CCACTCATGTGCCTCGATGT
MGST1 F: TTGGCGCGCGAATCTACCACA 239 NM_214300.1
R: TCCTCGGCTCCCTTCCCACTTA
UGT1A1 F: GATCCTTTCCTGCAACGCAT 313 XM_001927673
R: GGAAGGTCATGTGATCTGAG
IL-6 F: AGCAAGGAGGTACTGGCAGA 257 NM_001252429.1
R: GTGGTGGCTTTGTCTGGATT
IL-8 F: ACTTCCAAACTGGCTGTTGC 120 NM_213867.1
R: GGAATGCGTATTTATGCACTGG
IL-1β F: GTTCTCTGAGAAATGGGAGC 143 NM_214055.1
R: CTGGTCATCATCACAGAAGG
TNF-α CATGAGCACTGAGAGCATGA 170 NM_214022.1
CGATAACTTCGAAGTGCAGT
  1. GPx4, glutathione peroxidase 4; GPx1, glutathione peroxidase 1; CAT, catalase; SOD3, superoxide dismutase 3; SOD2, superoxide dismutase 2; SOD1, superoxide dismutase 1; NQO1, NAD(P)H quinone dehydrogenase 1; HO1, heme oxygenase 1; CYP1A1, cytochrome P450 family 1 subfamily A member 1; TXNRD1, thioredoxin reductase 1; GCLM, glutamate-cysteine ligase modifier; MGST1, microsomal glutathione S-transferase 1; UGT1A1, UDP glucuronosyl- transferase family 1 member A1; IL-1, interleukin 1; IL-6, interleukin 6; IL-8, interleukin 8; TNF-α, tumor necrosis factor α