Skip to main content

Advertisement

Table 2 Primer sequences used for RT-PCR, in situ hybridization, and qRT-PCR

From: Acquisition of pluripotency in the chick embryo occurs during intrauterine embryonic development via a unique transcriptional network

Gene Accession no. Forward (5′ → 3′) Reverse (5′ → 3′) Amplicon size, bp
RT-PCR or in situ hybridization
cNANOG NM_001146142 CAGCAGACCTCTCCTTGACC AAGCCCTCATCCTCCACAGC 586
cPOUV NM_001309372 GCCAAGGACCTCAAGCACAA ATGTCACTGGGATGGGCAGA 511
cSOX2 NM_205188 CACAACTCGGAGATCAGCAA GTAGGTAGGCGATCCGTTCA 471
cSOX3 NM_204195 CGGCACCGTACCACTAACTC GACTCGGAAGCGAACAAAAC 302
cGAPDH NM_204305 CACAGCCACACAGAAGACGG CCATCAAGTCCACAACACGG 443
qRT-PCR
cGAPDH NM_204305 ACACAGAAGACGGTGGATGG GGCAGGTCAGGTCAACAACA 193
cNANOG NM_001146142 CAGCAGACCTCTCCTTGACC AAAAGTGGGGCGGTGAGATG 187
cPOUV NM_001309372 TGAAGGGAACGCTGGAGAGC ATGTCACTGGGATGGGCAGAC 231
cSOX3 NM_204195 CGGCACCGTACCACTAACTC GACTCGGAAGCGAACAAAAC 302
cENS-1 NM_001080873 TGCTCGGCCTTCTGTATCAG TTCCTCTCGGAACTCCACAG 181
cTFCP2L1 XM_422087 TCAGCACATTAAAAGCTGAAAGCA AGCAATCTCAGTGAGGCACTA 110
cTBX3 NM_001270878 GTGGAAGACGACCCGAAAGT CACCATCTCCGTGCCTCTTT 78
cPRDM14 XM_015282907 AAATTCCCCTGCCACCTCTG CCCGCATGTGTTTGTTCAGG 154
cKIT NM_204361 AGCGAACTTCACCTTACCCG CTGGGAATCCAGTTGCCACA 181
cLIN28A NM_001031774 CCGAGAATGAGTCCCAACCC GGTGAATTCAACGGCTTCGC 197
cMYC NM_001030952 GAGGAGAACGACAAGAGGCG CACGCAGGGCAAAGAAACTC 85
cSALL4 NM_001080872 AATTCTGCCAGACGGGGAAG GCTATGCCATTGCTGAGCAC 170