Skip to main content

Advertisement

Table 1 Amplification and sequencing primers for the 16S rRNA and gyrB genes

From: Isolation of bacteria from fermented food and grass carp intestine and their efficiencies in improving nutrient value of soybean meal in solid state fermentation

Gene Primer Primer sequence (5′→3′)
16S rRNA BSF8/20 (Forward) AGAGTTTGATCCTGGCTCAG
  BSR534/18 (Reverse) ATTACCGCGGCTGCTGGC
gyrB UP-1 (Forward) GAAGTCATCATGACCGTTCTGCA(TC)GC(TCAG)GG(TCAG)GG(TCAG)AA(AG)TT(TC)GAGAAGTCATCATGACCGTTCTGCAYGCNGGNGGNAARTTYGA
  UP-2r (Reverse) AGCAGGGTACGGATGTGCGAGCC(AG)TC(TCAG)AC(AG)TC(TCAG)GC(AG)TC(TCAG)GTCATAGCAGGGTACGGATGTGCGAGCCRTCNACRTCNGCRTCNGTCAT
  UP1S (Forward) GAAGTCATCATGACCGTTCTGCA
  UP2SR (Reverse) AGCAGGGTACGGATGTGCGAGCC