Skip to main content

Table 3 The sequence of 16S rRNA quantitative real-time PCR primers used to quantify intestinal bacteria

From: Effects of Lactobacillus acidophilus on the growth performance and intestinal health of broilers challenged with Clostridium perfringens

Target Primer sequence (5′→3′)b Amplicon size, bp Reference
279 [40]
Escherichia subgroupa F: GTTAATACCTTTGCTCATTGA
340 [41]
Lactobacillus subgroup F: AGCAGTAGGGAATCTTCCA
341 [15]
  1. aThe targeted Escherichia subgroup contained E. coli, Hafnia alvei and Shigella species
  2. bF forward, R reverse