Skip to main content

Advertisement

Table 2 Quantitative real-time PCR primer sequences

From: Effects of Lactobacillus acidophilus on the growth performance and intestinal health of broilers challenged with Clostridium perfringens

Gene name Forward primer sequence (5′ to 3′) Reverse primer sequence (5′ to 3′) GenBank accession number
β-actin GAGAAATTGTGCGTGACATCA CCTGAACCTCTCATTGCCA L08165
IL-1β ACTGGGCATCAAGGGCTA GGTAGAAGATGAAGCGGGTC NM_204524
IL-8 ATGAACGGCAAGCTTGGAGCTG TCCAAGCACACCTCTCTTCCATCC AJ009800
IFN-γ AGCTGACGGTGGACCTATTATT GGCTTTGCGCTGGATTC NM_205149.1
TNF-α GAGCGTTGACTTGGCTGTC AAGCAACAACCAGCTATGCAC NM_204267
IL-10 CGGGAGCTGAGGGTGAA GTGAAGAAGCGGTGACAGC EF554720.1
MUC2 TTCATGATGCCTGCTCTTGTG CCTGAGCCTTGGTACATTCTTGT XM_421035
CLDN1 CATACTCCTGGGTCTGGTTGGT GACAGCCATCCGCATCTTCT AY750897.1
OCLN ACGGCAGCACCTACCTCAA GGGCGAAGAAGCAGATGAG GI:464,148
ZO-1 CTTCAGGTGTTTCTCTTCCTCCTC CTGTGGTTTCATGGCTGGATC XM_413773