Skip to main content

Table 1 PCR primers for glucose metabolism genes

From: Effects of chronic dexamethasone administration on hyperglycemia and insulin release in goats

Gene Sequence 5′→3’ GenBank accession no. Product length, bp
GLUT1 Forward: AACCGCAACGAGGAGAACC NM_001314223.1 155
GLUT2 Forward: GAGGCATATCAGGACTCTAC XM_005675321.3 156
SGLT1 Forward: CACCCATCGCAGCAGT XM_018060890.1 199
PCK1 Forward: ACGCGCTTCCCGAATTCTCA XM_004014441.1 130
IGF1R Forward: GGCTCAACCCAGGGAA XM_018065947.1 164
IR Forward: GCCCTGGTGTCACTTTCC XM_018051134.1 182
IRS1 Forward: TGCCTGACCAGCAAGACCA XM_018058864.1 187
PI3K Forward: CGAGCATTTCTGCTTTGGG XM_018047551.1 152
AKT Forward: CTAAGCAGCGGCTTGGTG NM_001285750.1 165
Atrogin1 Forward: TAAACTTGTGCGATGCTAC XM_005688865.3 167
MuRF1 Forward:GAGCAAGGCAGGTGAAGG XM_018058864.1 134
  1. GLUT1 Glucose transporter type 1, GLUT2 Glucose transporter type 2, SGLT1 Sodium glucose transporter type 1, Na-K/ATPase Sodium-potassium ATPase, GLUT4 Glucose transporter type 4, PCK1 Cytosolic form of phosphoenolpyruvate carboxykinase, PCK2 Mitochondrial form of phosphoenolpyruvate carboxykinase, PC Pyruvate carboxylase, HK Hexokinase, IGF1R Insulin-like growth factor 1 receptor, IR Insulin receptor, IRS1 Insulin receptor substrate1, PI3K Phosphoinositide 3-kinase, AKT AKT serine/threonine kinase 1, Atrogin1 F-box protein 32, MuRF1 Muscle RING-Finger protein 1, G6PC Glucose-6-phosphatase, GAPDH Glyceraldehyde-3-phosphate dehydrogenase