Skip to main content

Table 3 Primer sequences used for real-time PCR assay

From: Effects of dietary Bacillus amyloliquefaciens supplementation on growth performance, intestinal morphology, inflammatory response, and microbiota of intra-uterine growth retarded weanling piglets

Namea GenBankb Sequence, 5′ → 3’c Length, bp
β-actin XM_003124280.4 CTCCAGAGCGCAAGTACTCC 153
  1. aBAX B-cell CLL/lymphoma 2-associated X protein, β-actin beta actin, BCL-2 B-cell CLL/lymphoma 2, GAPDH glyceraldehyde phosphate dehydrogenase, MCL-1 myeloid cell leukemia 1, PLSCR3 phospholipid scramblase 3
  2. bGenBank Accession Number
  3. cShown as forward primer followed by reverse primer