Skip to main content

Table 2 Group-specific 16S–targeted primers and optimized conditions for real-time PCR

From: Effects of dietary Bacillus amyloliquefaciens supplementation on growth performance, intestinal morphology, inflammatory response, and microbiota of intra-uterine growth retarded weanling piglets

Name Sequence, 5′ → 3’a Annealing temperature, °C Product size, bp Reference
Total bacteria ACTCCTACGGGAGGCAGCAG 60 200 [33]
Lactobacillus AGCAGTAGGGAATCTTCCA 55 341 [34]
Escherichia coli CATGCCGCGTGTATGAAGAA 60 96 [35]
Bifidobacterium CTCCTGGAAACGGGTGG 55 550 [37]
  1. aShown as forward primer followed by reverse primer