Skip to main content

Advertisement

Table 3 PCR primers for real-time PCR assay

From: Effects of fumaric acid supplementation on methane production and rumen fermentation in goats fed diets varying in forage and concentrate particle size

Target specie Primer Primer sequence (5′ to 3′)
Bacteria a Forward CGGCAACGAGCGCAACCC
Reverse CCATTGTAGCACGTGTGTAGCC
Methanogen b Forward GAGGAAGGAGTGGACGACGGTA
Reverse ACGGGCGGTGTGTGCAAG
B. fibrisolvens b Forward GAGGAAGTAAAAGTCGTAACAAGGTTTC
Reverse CAAATTCACAAAGGGTAGGATGATT
F. succinogenes a Forward GTTCGGAATTACTGGGCGTAAA
Reverse CGCCTGCCCCTGAACTATC
R.flavefaciens a Forward CGAACGGAGATAATTTGAGTTTACTTAGG
Reverse CGGTCTCTGTATGTTATGAGGTATTACC
S. ruminantium b Forward GGCGGGAAGGCAAGTCAGTC
Reverse CCTCTCCTGCACTCAAGAAAGACAG
  1. aDenman and McSweeney, [27]; bKhafipour et al. [28]