Skip to main content

Table 3 PCR primers for real-time PCR assay

From: Effects of fumaric acid supplementation on methane production and rumen fermentation in goats fed diets varying in forage and concentrate particle size

Target specie Primer Primer sequence (5′ to 3′)
F. succinogenes a Forward GTTCGGAATTACTGGGCGTAAA
S. ruminantium b Forward GGCGGGAAGGCAAGTCAGTC
  1. aDenman and McSweeney, [27]; bKhafipour et al. [28]