Skip to main content

Table 2 Primer pairs for 16S rRNA genes of bacteria

From: Dietary proline supplementation alters colonic luminal microbiota and bacterial metabolite composition between days 45 and 70 of pregnancy in Huanjiang mini-pigs

Bacteria Phylum Primer sequences (5′ → 3′) Product size, bp References
Bacteroidetes Bacteroidetes F: AGCAGCCGCGGTAAT
R: CTAHGCATTTCACCGCTA
184 [62]
B. fibrisolvens Firmicutes F: CGCATGATGCAGTGTGAAAAGCTC
R: CCTCCCGACACCTATTATTCATCG
625 [63]
Bifidobacterium sp. Actinobacteria F: CTCCTGGAAACGGGTGG
R: GGTGTTCTTCCCGATATCTACA
226 [64]
C. coccoides Firmicutes F: AAATGACGGTACCTGACTAA
R: CTTTGAGTTTCATTCTTGCGAA
440 [65]
C. coccoides-E. rectale Firmicutes F: CGGTACCTGACTAAGAAGC
R: AGTTTYATTCTTGCGAACG
429 [65]
C. leptum subgroup Firmicutes F: GCACAAGCAGTGGAGT
R: CTTCCTCCGTTTTGTCAA
239 [66]
E. coli Proteobacteria F: GACCTCGGTTTAGTTCACAGA
R: CACACGCTGACGCTGACCA
96 [67]
F. prausnitzii a Firmicutes F: AATTCCGCCTACCTCTGCACT
R: GGAGGAAGAAGGTCTTCGG
248 [68]
Firmicutes Firmicutes F: GTCAGCTCGTGTCGTGA
R: CCATTGTAKYACGTGTGT
179 [69]
F. prausnitziib Bacteroidetes F: CCCTTCAGTGCCGCAGT
R: GTCGCAGGATGTCAAGAC
158 [70]
K. pneumoniae Proteobacteria F: CCTGGATCTGACCCTGCAGTA
R: CCGTCGCCGTTCTGTTTC
165 [71]
Lactobacillus sp. Firmicutes F: TACATCCCAACTCCAGAACG
R: AAGCAACAGTACCACGACC
116 [72]
M. elsdenii Firmicutes F: GACCGAAACTGCGATGCTAGA
R: TCCAGAAAGCCGCTTTCGCCACT
128 [73]
P. aeruginosa Proteobacteria F: TCCAAGTTTAAGGTGGTAGGCTG
R: CTTTTCTTGGAAGCATGGCATC
117 [74]
P. productus Firmicutes F: AACTCCGGTGGTATCAGATG
R: GGGGCTTCTGAGTCAGGTA
268 [67]
Pseudomonas Proteobacteria F: GAGTTTGATCCTGGCTCAG
R: CCTTCCTCCCAACTT
440 [75]
Prevotella Bacteroidetes F: CACRGTAAACGATGGATGCC
R: GGTCGGGTTGCAGACC
513 [64]
Roseburia Firmicutes F: TACTGCATTGGAAACTGTCG
R: CGGCACCGAAGAGCAAT
230 [76]
S. ruminantium Firmicutes F: TGCTAATACCGAATGTTG
R: TCCTGCACTCAAGAAAGA
513 [77]
Veillonella spp. Firmicutes F: A(C/T)CAACCTGCCCTTCAGA
R: CGTCCCGATTAACAGAGCTT
335 [70]
  1. a Faecalibacterium prausnitzii
  2. b Fusobacterium prausnitzii