Skip to main content

Advertisement

Table 1 Polymerase chain reaction primer sequences and product size

From: GLP1 and GIP are involved in the action of synbiotics in broiler chickens

Genes Forward primer (5′→3′) Reverse primer (5′→3′) Product Size, bp
GLP-1 CCAAGCGTCATTCTGAATTTG TGACCTTCCAAATAAGAGGTGATA 76
GIP CGCAGTGAGTGACCAAAGC TAGGAGCCATGCAAGGAAGT 67
GLP-1R GTGTACCGGTTCTGCACCTC GGGCAGAGTCGAGTTCTCCT 60
GIP-R GCGTTACCTCTACGAGAACGA GCGGATGATCCACCACAC 70
GAPDH GTGAAAGTCGGAGTCAACGG ACAGTGCCCTTGAAGTGTCC 170