Skip to main content

Advertisement

Table 2 Sequences of the oligonucleotide primers used for quantitative real-time PCRa

From: Effects of Bacillus coagulans supplementation on the growth performance and gut health of broiler chickens with Clostridium perfringens-induced necrotic enteritis

Gene Primer sequence 5′ → 3′ GenBank Accession No. Efficiencyb, %
GAPDH F: GGTGGTGCTAAGCGTGTTAT K01485 93.23
R: ACCTCTGTCATCTCTCCACA
TNFSF15 F: CCTGAGTATTCCAGCAACGCA NM010245578 113.59
R: ATCCACCAGCTTGATGTCACTAAC
IFN-γ F: AGCTGACGGTGGACCTATTATT Y07922 95.29
R: GGCTTTGCGCTGGATTC
TLR-2 F: CTGGGAAGTGGATTGTGGA AB050005.2 93.39
R: AAGGCGAAAGTGCGAGAAA
TLR-4 F: GGATCTTTCAAGGTGCCACA AY064697 98.08
R: CAAGTGTCCGATGGGTAGGT
MUC-2 F: GGGATATTCACCTGGAGAAACCATT XM_421045 100.41
R: TTGCATGTCCATCTGCCTGAA
LYZ F: CCCAGGCTCCAGGAACCT NM_205281 98.42
R: CACGCTCGCTGTTATGTCTGA
Fowlicidin-2 F: CAAGGAGAATGGGGTCATCAG NM_001605.3 85.54
R: CGTGGCCCCATTTATTCATTCA
  1. F forward, R reverse, GAPDH, glyceraldehyde-3-phosphate dehydrogenase, IFN-γ interferon-γ, IL interleukin, LYZ lysozyme, TLR toll-like receptor, TNFSF15 tumor necrosis factor super family 15
  2. aPrimers were designed and synthesized by Sango Biotech (Shanghai) Co., Ltd
  3. bPCR amplification efficiency of primers of each gene