Skip to main content

Advertisement

Table 2 Nucleotide sequences of specific primers

From: Dietary betaine activates hepatic VTGII expression in laying hens associated with hypomethylation of GR gene promoter and enhanced GR expression

Target genes GenBank accession Primer sequences (5′ to 3′) PCR products, bp
Primers used for QRT-PCR:
BHMT XM_414685.3 F: TCTTCCTGAATTTCCCTT R: TGAACATCCCATCTAGTGA 57
GNMT XM_015283546.1 F: GGAGGAGGGCTTCCAAGTGA R: GCTCCAGCGTCAGCCAGTT 140
DNMT1 NM_206952.1 F: CGAGTGGGACGGCTTCTT R: AGGCGATAGGTGTCAGGGA 144
VTGII NM_001031276.1 F: GAATCCTTCTCGACAAGCCAG R: GCTTCAGCAAAGACGTTCCAG 186
ERα NM_205183.2 F: TAGTTCCGCTCTACGACCTCTT R: AGTTGGTTTCGGTTCTCCTCTT 106
ERβ NM_204794.2 F: AGCGTGTTATGGTCTGCTCC R: GCTCTTAGGCTGCTCTGCAT 87
GR NM_001037826.1 F: CTTCCATCCGCCCTTCA R: TCGCATCTGTTTCACCC 203
β-actin NM_205518.1 F: ATG GCTCCGGTATGTGCA A R: TGTCTTTCTGGCCCATACCAA 120
Primers used for Bisulfite sequencing of GR promoter:  
 Segment 1   F: TGTTATTTTGTAGAAGTGGGTGTGTTAG R: TAAACAACTTCRCACAACCCATTC  
 Segment 2   F: GAATGGGTTGTGYGAAGTTGTTTA R: TTAAAATAACCCRACCRAATACTCC  
 Segment 3   F: GTAYGGAGTYGTTTTGTTGGTTG R: ACTATCCTCCAAACCCATCTAATACC  
 Segment 4   F: TTATTTGTAAATGTGGGGTTTATTTATAG R: TATAAACACTCCCCAACTCTACTATAACC