Skip to main content

Advertisement

Table 1 Sequences of oligonucleotide primers used for real time-PCR

From: Plasma and cerebrospinal fluid interleukin-1β during lipopolysaccharide-induced systemic inflammation in ewes implanted or not with slow-release melatonin

GenBank Acc. No. Gene Amplicon size, bp Temp. of primers annealing, °C Forward/ reverse Sequence 5′ → 3′ Reference
X54796.1 Il1B 137 59 forward CAGCCGTGCAGTCAGTAAAA [35]
reverse GAAGCTCATGCAGAACACCA
NM_001206735.1 Il1r1 124 59 forward GGGAAGGGTCCACCTGTAAC [35]
reverse ACAATGCTTTCCCCAACGTA
NM_001046210 Il1r2 161 59 forward CGCCAGGCATACTCAGAAA [36]
reverse GAGAACGTGGCAGCTTCTTT
XM_004015970.1 Mmp3 112 60 forward AAGGCAGACATTTTTGGCGG Originally designed
reverse ATGCCTCTTGGGGAACCTGC
XM_004014614.1 Mmp9 115 60 forward CTTCCGATGGAAAGAACGGGC Originally designed
reverse GGGATCACAACGCCTTTGC
NM_001034034 Gapdh 143 60 forward TGACCCCTTCATTGACCTTC [27]
reverse GATCTCGCTCCTGGAAGATG
NM_001009784.1 Actb 122 60 forward GCCAACCGTGAGAAGATGAC [27]
reverse TCCATCACGATGCCAGTG
BC_108088.1 Hdac1 115 60 forward CTGGGGACCTACGGGATATT [35]
reverse GACATGACCGGCTTGAAAAT