Skip to main content

Table 2 Forward and reverse primers of myogenesis-related genes and reference genes1

From: Impact of dietary l-arginine supply during early gestation on myofiber development in newborn pigs exposed to intra-uterine crowding

  Accession no. Forward primer (from 5’ to 3’) Reverse primer (from 5’ to 3’)
Gene
IGF2 NM_213883 TGGCATCGTGGAAGAGTG AGGTGTCATAGCGGAAGAAC
IGFBP5 U41340 GTGTACCTGCCCAACTGTGA AAGCTGTGGCACTGGAAGTC
MSTN NM_214435 CCCGTCAAGACTCCTACAACA CACATCAATGCTCTGCCAA
MYF5 Y17154 CCTGAATGCAACAGCCCT CGGAGTTGCTGATCCGAT
MYF6 NM_001244672 CGCCATCAACTACATCGAGAGGT ATCACGAGCCCCCTGGAAT
MYOD1 NM_001002824 GGTGACTCAGACGCATCCA ATAGGTGCCGTCGTAGCAGT
MYOG NM_001012406 CAACCAGGAGGAGCGAGAC GAGGTGAGGGAGTGCAGATT
PRKAA2 NM_214266 CCCCTGAAACGAGCAACTATC CACACTTCTTTCACAGCCTCAT
Reference genes
RPL4 DQ845176 CAAGAGTAACTACAACCTTC GAACTCTACGATGAATCTTC
TBP DQ178129 GATGGACGTTCGGTTTAGG AGCAGCACAGTACGAGCAA
  1. 1 IGF2 Insulin-like growth factor 2, IGFBP5 Insulin-like growth factor binding protein 5, MSTN Myostatin, MYF5 myogenic factor 5, MYF6 myogenic factor 6, MYOD1 Myogenic differentiation 1, MYOG Myogenin (myogenic factor 4), PRKAA2 Protein kinase AMP-activated, alpha 2 catalytic subunit, RPL4 (LOC100038029) Ribosomal protein L4, TBP TATA box binding protein