Skip to main content

Advertisement

Table 1 Primers Used for Real-Time PCR

From: Association of growth rate with hormone levels and myogenic gene expression profile in broilers

Gene GenBank Accession Number Primer Sequence (5' to 3') Product Size, bp
IGF-1 NM_001004384 GAGCTGGTTGATGCTCTTCAGTT 148
CCAGCCTCCTCAGGTCACAACT
MSTN NM_001001461 CGCTACCCGCTGACAGTGGAT 132
CAGGTGAGTGTGCGGGTATTTCT
MyoD1 NM_204214 CCGACGGCATGATGGAGTACA 131
GTCGAGGCTGGAAACAACAGAA
Myogenin D90157 GGAGGCTGAAGAAGGTGAACGA 127
CTCTGCAGGCGCTCGATGTACT
MRF4 D10599 CAGGCTGGATCAGCAGGACAA 106
GCCGCAGGTGCTCAGGAAGT
Myf5 NM_001030363 CAGAGACTCCCCAAAGTGGAGAT 106
GTCCCGGCAGGTGATAGTAGTTC
MEF2A NM_204864 CGGAGGACAGATTCAGCAAACTA 109
GACACTGGAACCGTAACCGACAT
MEF2B XM_430389 CACGCCATCAGCATCAAGTCA 156
GGGGTAGCCCTTGGAGTAGTCAT
MEF2C XM_001231661 GCCGTCTGCCCTCAGTCAACT 137
GGGTGGTGGTACGGTCTCTAGGA
MEF2D NM_001031600 GTGTCTCCCAAGCGACTCACTCT 109
GTGTTGTATGCGGTCGGCAT
GAPDH NM_204305 GCCACACAGAAGACGGTGGAT 86
GTGGACGCTGGGATGATGTTCT
18S AF173612 CCGGACACGGACAGGATTGACA 94
CAGACAAATCGCTCCACCAACTAAG