Effect of Bacillus subtilis and Bacillus licheniformis supplementation in diets with low- and high-protein content on ileal crude protein and amino acid digestibility and intestinal microbiota composition of growing pigs

Table 2 Oligonucleotide primers used for real-time PCR

Target group	Item	Oligonucleotide sequence (5′→3′)	Primer conc., nmol/L	Annealing temp., °C	Product size, bp	Reference
Total bacteria	Forward	GTGSTGCAYGGYYGTCGTCA	600	52	147	Fuller et al. [80]
Total bacteria	Reverse	ACGTCRTCCMCNCCTTCCTC	600	52	147	Fuller et al. [80]
Lactobacillus spp.	Forward	AGAGGTAGTAACTGGCCTTTA	400	59	391	Malinen et al. [81]
Lactobacillus spp.	Reverse	GCGGAAACCTCCCAACA	400	59	391	Malinen et al. [81]
Bifidobacterium spp.	Forward	TCGCGTCYGGTGTGAAAG	400	59	243	Rinttilä et al. [82]
Bifidobacterium spp.	Reverse	CCACATCCAGCRTCCAC	400	59	243	Rinttilä et al. [82]
Roseburia spp.	Forward	AGGCGGTACGGCAAGTCT	400	59	353	Veiga et al. [83]
Roseburia spp.	Reverse	AGTTTYATTCTTGCGAACG	400	59	353	Rinttilä et al. [82]
Enterobacteriaceae	Forward	CATTGACGTTACCCGCAGAAGAAGC	200	59	195	Bartosch et al. [84]
Enterobacteriaceae	Reverse	CTCTACGAGACTCAAGCTTGC	200	59	195	Bartosch et al. [84]
Clostridium Cluster IV	Rflbr730F	GGCGGCYTRCTGGGCTTT	400	65	147	Ramirez-Farias et al. [85] Lay et al. [86]
Clostridium Cluster IV	Clep866mR§	CCAGGTGGATWACTTATTGTGTTAA	400	65	147	Ramirez-Farias et al. [85] Lay et al. [86]
Bacteroides-Prevotella-Porphyromonas	Forward	GGTGTCGGCTTAAGTGCCAT	600	58	140	Rinttilä et al. [82]
Bacteroides-Prevotella-Porphyromonas	Reverse	CGGAYGTAAGGGCCGTGC	600	58	140	Rinttilä et al. [82]
Bacillus spp.	Forward	CCTACGGGAGGCAGCAGTAG	600	59	78	Fernández-No et al. [87]
Bacillus spp.	Reverse	GCGTTGCTCCGTCAGACTTT	600	59	78	Fernández-No et al. [87]

ISSN: 2049-1891