Skip to main content


Table 2 Oligonucleotide primers used for real-time PCR

From: Effect of Bacillus subtilis and Bacillus licheniformis supplementation in diets with low- and high-protein content on ileal crude protein and amino acid digestibility and intestinal microbiota composition of growing pigs

Target group Item Oligonucleotide sequence (5′→3′) Primer conc., nmol/L Annealing temp., °C Product size, bp Reference
Total bacteria Forward GTGSTGCAYGGYYGTCGTCA 600 52 147 Fuller et al. [80]
Lactobacillus spp. Forward AGAGGTAGTAACTGGCCTTTA 400 59 391 Malinen et al. [81]
Bifidobacterium spp. Forward TCGCGTCYGGTGTGAAAG 400 59 243 Rinttilä et al. [82]
Roseburia spp. Forward AGGCGGTACGGCAAGTCT 400 59 353 Veiga et al. [83]
Reverse AGTTTYATTCTTGCGAACG Rinttilä et al. [82]
Enterobacteriaceae Forward CATTGACGTTACCCGCAGAAGAAGC 200 59 195 Bartosch et al. [84]
Clostridium Cluster IV Rflbr730F GGCGGCYTRCTGGGCTTT 400 65 147 Ramirez-Farias et al. [85]
Lay et al. [86]
Bacteroides-Prevotella-Porphyromonas Forward GGTGTCGGCTTAAGTGCCAT 600 58 140 Rinttilä et al. [82]
Bacillus spp. Forward CCTACGGGAGGCAGCAGTAG 600 59 78 Fernández-No et al. [87]