Skip to main content

Table 2 Primers used in this study

From: Effects of Saccharomyces cerevisiae fermentation products on performance and rumen fermentation and microbiota in dairy cows fed a diet containing low quality forage

Target Primer sequences (5′→3′) Product size, bp Reference
Total bacteria F CGGCAACGAGCGCAACCC 130 [27]
Ruminococcus albus F CCCTAAAAGCAGTCTTAGTTCG 175 [29]
Fibrobacter succinogenes F GTTCGGAATTACTGGGCGTAAA 121 [27]
Selenomonas ruminantium F TGCTAATACCGAATGTTG 515 [30]
Megasphaera elsdenii F GACCGAAACTGCGATGCTAGA 128 [31]
Streptococcus bovis F ATGTTAGATGCTTGAAAGGAGCAA 90 [32]