Skip to main content

Advertisement

Table 2 Primers used in this study

From: Effects of Saccharomyces cerevisiae fermentation products on performance and rumen fermentation and microbiota in dairy cows fed a diet containing low quality forage

Target Primer sequences (5′→3′) Product size, bp Reference
Total bacteria F CGGCAACGAGCGCAACCC 130 [27]
R CCATTGTAGCACGTGTGTAGCC   [27]
Protozoa F GCTTTCGWTGGTAGTGTATT 223 [28]
R CTTGCCCTCYAATCGTWCT   [28]
Fungi F GAGGAAGTAAAAGTCGTAACAAGGTTTC 120 [27]
R CAAATTCACAAAGGGTAGGATGATT   [27]
Ruminococcus albus F CCCTAAAAGCAGTCTTAGTTCG 175 [29]
R CCTCCTTGCGGTTAGAACA   [29]
R. flavefaciens F CGAACGGAGATAATTTGAGTTTACTTAGG 132 [27]
R CGGTCTCTGTATGTTATGAGGTATTACC   [27]
Fibrobacter succinogenes F GTTCGGAATTACTGGGCGTAAA 121 [27]
R CGCCTGCCCCTGAACTATC   [27]
Selenomonas ruminantium F TGCTAATACCGAATGTTG 515 [30]
R TCCTGCACTCAAGAAAGA   [30]
Megasphaera elsdenii F GACCGAAACTGCGATGCTAGA 128 [31]
R CGCCTCAGCGTCAGTTGTC   [31]
Streptococcus bovis F ATGTTAGATGCTTGAAAGGAGCAA 90 [32]
  R CGCCTTGGTGAGCCGTTA   [32]