Skip to main content

Table 1 Primer pairs of PCR and real time qRT-PCR used in the present study

From: Novel SNPs in IL-17F and IL-17A genes associated with somatic cell count in Chinese Holstein and Inner-Mongolia Sanhe cattle

SNP Gene Upper Primer (5’–3’) Lower Primer (5’–3’) PCR type
1 IL-17F GTCATTGGAACATCTCAGGAC GCAGATCAGCTCAGCTGAAGA Normal PCR
2 IL-17F ATAATAGTCCTTACATTGACT GCAAAGCATCAGGAGAGGTTG Normal PCR
3 IL-17F TGACCTGCTTACTGCCTAAGT TAAGAGATTTGCTATAGAGTG Normal PCR
4 IL-17F TGACCTGCTTACTGCCTAAGT TAAGAGATTTGCTATAGAGTG Normal PCR
5 IL-17F AACCAAAATGGATTAGCAAGT GTACAGGGCCAGTTAGTGAA Normal PCR
6 IL-17F AACCAAAATGGATTAGCAAGT GTACAGGGCCAGTTAGTGAA Normal PCR
7 IL-17F AACCAAAATGGATTAGCAAGT GTACAGGGCCAGTTAGTGAA Normal PCR
8 IL-17F AACCAAAATGGATTAGCAAGT GTACAGGGCCAGTTAGTGAA Normal PCR
9 IL-17A CAGTTCAAGTACACAAATGAGC GGTGTTTATCCATCCTACATAC Normal PCR
10 IL-17A TATGAGTATCTGTTTTGCCTAG CAGTTAGACTTGCTGTCTCTCT Normal PCR
11 IL-17A TATGAGTATCTGTTTTGCCTAG CAGTTAGACTTGCTGTCTCTCT Normal PCR
12 IL-17A TATGAGTATCTGTTTTGCCTAG CAGTTAGACTTGCTGTCTCTCT Normal PCR
  IL-17A AGGGTCAACCTAAACATCGTT GTACCTCTCAGGGTCCTCATT Real-time PCR
  IL-4 AGGGTTGGAATTGAGCTTAGG TGGCTTCATTCACAGAACAGG Real-time PCR
  GADPH GCTGCTTTTAATTCTGGC CTTTCCATTGATGACGAG Real-time PCR