Skip to main content

Advertisement

Table 1 The primer sequences

From: Over-expression of Toll-like receptor 2 up-regulates heme oxygenase-1 expression and decreases oxidative injury in dairy goats

Primer Forward (5'→3') Reverse (5'→3')
TLR2 TGCTGTGCCCTCTTCCTGTT GGGACGAAGTCTCGCTTATGAA
AP-1 GAAGGAAGAGCCGCAGACG CCACCTGTTCCCTGAGCATA
NF-κB TTCTCCAAATGGCTGAAGGTA TTGTTTGAGGGCCATAAGGAT
Nrf2 CCAACTACTCCCAGGTAGCCC AGCAGTGGCAACCTGAACG
c-Fos GAGGACCTTATCTGTGCGTGAA GGTTAATTCCAATAACGAACCCAAT
c-Jun AAGATGGAAACGACCTTCTACGA TTGATCCGCTCCTGGGACT
PI3K CCGACAGTGAGCAACAAGC AGGAGGCGGCATCACAATC
CAT TTTTCTGCTGAAGCCCTATGA GTCCTTTCAGGGAGAATGGTG
GSTα1 TGAGCCAAGTGGGAGACAGAC ATCCAGGTCTTCTGGTTGTTCTAT
SOD1 TCTGCGTGCTGAAGGGTGA CTTTGGCCCACCGTGTTTT
HO-1 ACACCCAGGCGGAGAATG CTCCTGGAGTCGCTGAACATAG
NQO1 AACTTCAATCCCGTCATCTCC CCTTTCAGGATGGCAGGGACT
β-actin AGATGTGGATCAGCAAGCAG CCAATCTCATCTCGTTTTCTG