Skip to main content

Table 3 The primer sequences of the target genes

From: Transfer of β-hydroxy-β-methylbutyrate from sows to their offspring and its impact on muscle fiber type transformation and performance in pigs

Target gene Primer sequence (5′to 3′) Product size, bp GenBank No.
MyHC1 F: GTTTGCCAACTATGCTGGGG 95 NM_213855.1
R: TGTGCAGAGCTGACACAGTC
MyHCIIa F: CTCTGAGTTCAGCAGCCATGA 127 NM_214136.1
R: GATGTCTTGGCATCAAAGGGC
MyHCIIx F: TTGACTGGGCTGCCATCAAT 111 NM_001104951.1
R: GCCTCAATGCGCTCCTTTTC
MyHCIIb F: GAGGTACATCTAGTGCCCT 83 NM_001123141.1
R: GCAGCCTCCCCAAAAATAGC
Pax7 F: TGAAGGTCGGAGTGAACGGAT 74 NM_001206359.1
R: CACTTTGCCAGAGTTAAAAGCA
IGF-1 F: CACAGACGGGCATCGTGGAT 90 NM_214256.1
R: ACTTGGCAGGCTTGAGGGGT
mTOR F: CATTGGAGATGGTTTGGTGA 160 XM_003127584.5
R: ATGGGATGTGGCTTGTTTGA
MRF4 F: CCTTCGGTGCCTTTCTTCCAT 88 NM_001244672.1
R: GAGTTATTTCTCCCCCACTTCC
MSTN F: TTTACCTGTTTATGCTGATTGTTG 194 NM_214435.2
R: TTTGCTAATGTTAGGAGCTGTTTC
FoxO1 F: TCAAGGATAAGGGCGACAGC 95 NM_214014.2
R: AATGTCATTATGGGGAGGAGAGT
Sox6 F: CGGATTGGGGAGTATAAGCA 159 XM_01399454.1
R: CATCTGAGGTGATGGTGTGG
MAFbx F: CCCTCTCATTCTGTCACCTTG 104 NM_001044588
R: ATGTGCTCTCCCACCATAGC
MuRF1 F: GCTGGATTGGAAGAAGATGTAT 144 NW_001184756
R: AGGAAAGAATGTGGCAGTGTCT
GAPDH F: TGAAGGTCGGAGTGAACGGAT 74 NM_001206359.1
R: CACTTTGCCAGAGTTAAAAGCA
  1. MyHC myosin heavy chain, Pax7 paired box 7, IGF-I insulin-like growth factor-I, mTOR mammalian target of rapamycin, MRF4 muscle regulator factor 4, MSTN myostatin, FoxO1 forkhead box transcription factor O1, MAFbx muscle atrophy F-box, MuRF1 muscle Ring finger 1, GAPDH glyceraldehyde-3-phosphate dehydrogenase