Skip to main content

Table 1 Sequences of oligonucleotide primers used for qRT-PCR

From: Examination of the molecular control of ruminal epithelial function in response to dietary restriction and subsequent compensatory growth in cattle

Gene namea Accession number Primer sequences Amplicon size, bp
Endogenous control
RPLP0 NM_001012682 F: AGGGCGTCCGCAATGTT 54
  R: CGACGGTTGGGTAACCAATC  
GAPDH NM_001034034 F: GATTGTCAGCAATGCCTCCT 135
  R: CCATCCACAGTCTTCTGGGT  
ATP5B NM_175796 F: CCCTCAAGGAGACCATCAAA 184
  R: GGACACCATGGAGGATGAGT  
HPRT1 NM_001034035 F: GCCGACCTGTTGGATTACAT 205
  R: GCATTGTCTTCCCAGTGTCA  
B2M NM_173893 F: AGCGTCCTCCAAAGATTCAA 156
  R: ACAGGTCTGACTGCTCCGAT  
Cellular structure and growth
CCND1 NM_001046273 F: GCACTTCCTCTCCAAGATGC 204
  R: GTCAGGCGGTGATAGGAGAG  
CCND2 NM_001076372 F: CCAGACCTTCATCGCTCTGT 163
  R: GATCTTTGCCAGGAGATCCA  
CCND3 NM_001034709 F: TCCAAGCTGCGCGAGACTAC 178
  R: GAGAGAGCCGGTGCAGAATC  
CCNE1 XM_612960 F: TTGACAGGACTGTGAGAAGC 187
  R: TTCAGTACAGGCAGTGGCGA  
CCNE2 NM_001015665 F: CTGCATTCTGAGTTGGAACC 229
  R: CTTGGAGCTTAGGAGCGTAG  
CDKN1A NM_001098958 F: GCAGACCAGCATGACAGATT 205
  R: GTATGTACAAGAGGAGGCGT  
CDKN2A XM_868375 F:GTGCGCCGGTTCTTGATTAC 105
  R: CCCATCATCATCACCCGCTG  
CDKN2B NM_001075894 F: GCGGTGGATTATCCTGGACA 210
  R: CATCATCATCACCTGGATCG  
DSG1 NM_174045.1 F: AGACAGAGAGCAATATGGCCAGT 121
  R: TTCACACTCTGCTGACATACCATCT  
VFA activation
ACS DQ489534 F: GCTCTCACTGAGGAGCTCAAGAA 64
  R: AATCCGGTGTGGCAATGG  
ACSS1 BC114698.1 F: CCGATCAGGTCCTGGTAGTGA 200
  R: GAGCCATCACTTGGCACCTC  
PCCA BC123876 F: AGAATGGAAGATGCCCTGGAT 70
  R: CCTCTCGAAGCAATGCGATAT  
Transport Proteins
CACT NM_001077936.2 F: TCACGCTCATGCGAGATGTT 94
  R: TTGACGCTCTTTCCCTCTGG  
NHE1 NM_174833.2 F: CCGTCACTGTGGTCCTGTAT 88
  R: CTCAGGAAGCCGAGGATGAT  
NHE2 XM_604493 F: TGCTCATCATGGTGGGACTT 83
  R: CACATCAGTCTTCATGGCCG  
NHE3 AJ131764.1 F: AGGTGCAGCTGGAGATCAT 102
  R: GACCTTGTTCTCGTCCAGGA  
Ketogenesis
ACAT NM_001034319.1 F: AATAGGCAGTGTTCGTCGGG 102
  R: CATGGACTCCACCCCACAAG  
HMGCL NM_001075132 F: TGCAGATGGGAGTGAGTGTCA 73
  R: GACGCCCCCTGTGCATAG  
BDH1 NM_001034600 F: GACTGCCACCACTCCCTACAC 59
  R: TCCGCAGCCACCAGTAGTAGT  
BDH2 NM_001034488 F: CTGAAGAGGCACTGAGCGAT 98
  R: ATCAGAGGCCAAGTACACGC  
HMGCS1 AY581197 F: AGGATACTCATCACTTGGCCAACT 67
  R: CATGTTCCTTCGAAGAGGGAAT  
HMGCS2 NM_001045883 F: TCTGGCCCATCACTCTGCC 126
  R: AGTGGGGAGCCTGGAGAAGC  
Pyruvate Metabolism
LDHa BC146210 F: GGCAAAGACTATAATGTGACAGCAA 60
  R: ACGTGCCCCAGCTGTGA  
LDHb BC142006 F: CCAACCCAGTGGATATTCTCACA 66
  R: TCACACGGTGCTTGGGTAATC  
PC NM_177946 F: CTCCCACCATCTGTCCTTTCC 72
  R: TTTATTTGGGCAGGAGATGAATACG  
PDHA1 NM_001101046 F: CAGTTTGCTACTGCTGATCCTGAA 72
  R: AGGTGGATCGTTGCAGTAAATGT  
  1. a RPLP0 ribosomal protein large P0, GAPDH glyceraldehyde 3-phosphate dehydrogenase, ATP5B ATP synthase subunit β, HPRT1 hypoxanthine phosphoribosyltransferase 1, B2M β2 microglobulin, CCND1 cyclin D1, CCND2 cyclin D2, CCND3 cyclin D3, CCNE1 cyclin E1, CCNE2 cyclin E2, CDKN1A cyclin dependant kinase inhibitor 1A, CDKN2A cyclin dependant kinase inhibitor 2A, CDKN2B cyclin dependant kinase inhibitor 2B, DSG1 desmoglein 1, ACS acetyl coA synthetase, ACSS1 acyl coA synthetase short-chain family member 1, PCCA propionyl coA carboxylase α polypeptide, CACT solute carrier family 25, carnitine/acylcarnitine translocase member 20, NHE1 NA+/H+ exchanger isoform 1, NHE2 NA+/H+ exchanger isoform 2, NHE3 NA+/H+ exchanger isoform 3, ACAT acetyl coA acyltransferase, HMGCL 3-Hydroxymethyl-3-methylglutaryl-coA lyase, hydroxymethylglutaricaacidura, BDH1 3-Hydroxybutyrate dehydrogenase, type 1, BDH2 3-Hydroxybutyrate dehydrogenase, type 2, HMGCS1 3-Hydroxy-3-methylglutaryl-coA synthase 1, HMGCS2 3-Hydroxy-3-methylglutaryl-coA synthase 2, LDHa lactate dehydrogenase isoform a, LDHb lactate dehydrogenase isoform b, PC pyruvate carboxylase, PDHA1 pyruvate dehydrogenase lipoamide, α 1