Skip to main content

Table 2 The Primers used for real-time PCR analysis

From: Effects of dietary protein restriction on muscle fiber characteristics and mTORC1 pathway in the skeletal muscle of growing-finishing pigs

Genes Primer sequences (5’→3’) Product size, bp Accession NO.
β-actin F: TGCGGGACATCAAGGAGAAG 216 XM003357928.2
  1. MyHC myosin heavy chain, MyoD myoblast determination protein, MyoG myogenin, IL-6 interleukin-6, IL-15 interleukin-15, MuRF1 muscle ring finger 1, MAFbx muscle atrophy F-box