Skip to main content

Advertisement

Table 2 The Primers used for real-time PCR analysis

From: Effects of dietary protein restriction on muscle fiber characteristics and mTORC1 pathway in the skeletal muscle of growing-finishing pigs

Genes Primer sequences (5’→3’) Product size, bp Accession NO.
MyHC I F: GGCCCCTTCCAGCTTGA 63 L10129
R: TGGCTGCGCCTTGGTTT   
MyHC IIa F: TTAAAAAGCTCCAAGAACTGTTTCA 100 U11772
R: CCATTTCCTGGTCGGAACTC   
MyHC IIx F: AGCTTCAAGTTCTGCCCCACT 76 U90719
R: GGCTGCGGGTTATTGATGG   
MyHC IIb F:CACTTTAAGTAGTTGTCTGCCTTGAG 80 U90720
R: GGCAGCAGGGCACTAGATGT   
MyoD F: CAACAGCGGACGACTTCTATG 383 NM001002824
R: GCGCAAGATTTCCACCTT   
MyoG F: GCAGGGTGCTCCTCTTCA 230 NM001012406
R: AGGCTACGAGCGGACTGA   
IL-6 R: AGTTGAAGGTGGTCTCGTGG 118 NM001252429
R: TCTGCCAGTACCTCCTTGCT   
IL-15 F: GCATCCAGTGCTACTTGTGT 118 NM214390
R: TGCCAGGTTGCTTCTGTTTT   
MuRF1 F:AGCACGAAGACGAGAAAATC 150 NM001184756
R:TGCGGTTACTCAGCTCAGTC   
MAFbx F:CCAGAGAGTCGGCAAGT 374 NM001044588
R:GAGGGTAGCATCGCACAAGT   
β-actin F: TGCGGGACATCAAGGAGAAG 216 XM003357928.2
R: AGTTGAAGGTGGTCTCGTGG   
  1. MyHC myosin heavy chain, MyoD myoblast determination protein, MyoG myogenin, IL-6 interleukin-6, IL-15 interleukin-15, MuRF1 muscle ring finger 1, MAFbx muscle atrophy F-box